BLASTN 2.1.2 [Nov-13-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

RID: 982505350-26582-16353


Database: nt
           775,058 sequences; 2,752,804,350 total letters

 
If you have any problems or questions with the results of this search 
please refer to the BLAST FAQs


Taxonomy reports


Query= 
         (842 letters)



                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|2085776|gb|AC002089.1|AC002089  Human BAC clone CTA-308B2...    40  1.9
gi|4071052|emb|AL032822.1|HS59B16  Human DNA sequence from c...    40  1.9
gi|11466457|ref|NC_002174.1|  Chrysodidymus synuroideus mito...    38  7.3
gi|7110454|gb|AF222718.1|AF222718  Chrysodidymus synuroideus...    38  7.3
gi|10727917|gb|AE003531.2|AE003531  Drosophila melanogaster ...    38  7.3
gi|3482960|gb|AC004148.1|AC004148  Homo sapiens chromosome 1...    38  7.3
gi|5776573|gb|AC007514.5|AC007514  Homo sapiens chromosome 1...    38  7.3
gi|4309946|gb|AC005969.4|AC005969  Homo sapiens chromosome 1...    38  7.3
gi|4938290|emb|AL031431.8|HS462O23  Human DNA sequence from ...    38  7.3
gi|63569|emb|X07775.1|GGLEP100  Chicken mRNA for membrane gl...    38  7.3

Alignments
>gi|2085776|gb|AC002089.1|AC002089 Human BAC clone CTA-308B22 from 7q22-q31, complete sequence [Homo
             sapiens]
          Length = 148416

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 485   acaatgaggtaatgctgagttgttgggg 512
             |||||||||||  |||||||||||||||
Sbjct: 18344 acaatgaggtagagctgagttgttgggg 18317



>gi|4071052|emb|AL032822.1|HS59B16 Human DNA sequence from clone 59B16 on chromosome 6p22.1-22.3. Contains
             a pseudogene similar to GPISG20 and other exonucleases).
             Contains ESTs, STSs, GSSs, genomic markers D6S1691 and
             D6S299 and a ca repeat polymorphism, complete sequence
             [Homo sapiens]
          Length = 99902

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 564   agaatgggtaaaaggttgtg 583
             ||||||||||||||||||||
Sbjct: 55169 agaatgggtaaaaggttgtg 55188



>gi|11466457|ref|NC_002174.1| Chrysodidymus synuroideus mitochondrion, complete genome
          Length = 34119

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 538  gtggtgttgttgctatgat 556
            |||||||||||||||||||
Sbjct: 9535 gtggtgttgttgctatgat 9553



>gi|7110454|gb|AF222718.1|AF222718 Chrysodidymus synuroideus mitochondrion, complete genome
          Length = 34119

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 538  gtggtgttgttgctatgat 556
            |||||||||||||||||||
Sbjct: 9535 gtggtgttgttgctatgat 9553



>gi|10727917|gb|AE003531.2|AE003531 Drosophila melanogaster genomic scaffold 142000013386050 section 37 of
             54, complete sequence
          Length = 274351

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 531   ggttgatgtggtgttgttg 549
             |||||||||||||||||||
Sbjct: 18352 ggttgatgtggtgttgttg 18370



>gi|3482960|gb|AC004148.1|AC004148 Homo sapiens chromosome 17, clone HCIT524C5, complete sequence
          Length = 118276

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 117   acgaaactgctggataggg 135
             |||||||||||||||||||
Sbjct: 66205 acgaaactgctggataggg 66223



>gi|5776573|gb|AC007514.5|AC007514 Homo sapiens chromosome 14 clone BACs 209A20 and 396N8 map 14q31,
              complete sequence
          Length = 177720

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 243    ggttaatatgtggaaaatt 261
              |||||||||||||||||||
Sbjct: 129086 ggttaatatgtggaaaatt 129068



>gi|4309946|gb|AC005969.4|AC005969 Homo sapiens chromosome 17, clone hRPK.215_P_18, complete sequence
          Length = 147244

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 242   tggttaatatgtggaaaat 260
             |||||||||||||||||||
Sbjct: 39284 tggttaatatgtggaaaat 39302



>gi|4938290|emb|AL031431.8|HS462O23 Human DNA sequence from clone 462O23 on chromosome 1p35.1-36.12.
             Contains genes for two novel proteins, ESTs, STSs, GSSs
             and putative CpG island, complete sequence [Homo sapiens]
          Length = 154154

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 423   tggggaaaggttctggtgt 441
             |||||||||||||||||||
Sbjct: 82448 tggggaaaggttctggtgt 82430



>gi|63569|emb|X07775.1|GGLEP100 Chicken mRNA for membrane glycoprotein LEP100
          Length = 2058

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 778  acaagtttgggggaatggaagaa 800
            |||||||||||| ||||||||||
Sbjct: 1557 acaagtttggggcaatggaagaa 1579




  Database: nt
    Posted date:  Feb 10, 2001 12:06 PM
  Number of letters in database: 2,752,804,350
  Number of sequences in database:  775,058
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 917951
Number of Sequences: 775058
Number of extensions: 917951
Number of successful extensions: 16341
Number of sequences better than 10.0: 11
length of query: 842
length of database: 2,752,804,350
effective HSP length: 21
effective length of query: 821
effective length of database: 2,736,528,132
effective search space: 2246689596372
effective search space used: 2246689596372
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)